human cyclin b1 Search Results


92
R&D Systems pab cyclin b1
Interaction analysis of TB40-IE2-YFP ORF-UL97 resistance mutants with human <t>cyclins.</t> HFFs in T75 flasks were infected with HCMV TB40-IE2-YFP WT or newly generated ORF-UL97 point mutants. Cells were harvested between 4 and 7 d.p.i., when approximately 80% of the cells showed a cytopathic effect. Cells were lysed, and human cyclins T1 ( A ), H ( B ), and <t>B1</t> ( C ) were immunoprecipitated using specific antibodies. A chicken Fc fragment served as specificity control, and lysate taken prior to immunoprecipitation was used as input control. All samples were subjected to Wb analysis, and proteins were detected using specific monoclonal and polyclonal antibodies. ( D ) A summary is given of biological replicates (Rep1, Rep2, Rep3) monitoring the interaction of pUL97 mutants with human cyclins T1, H, and B1.
Pab Cyclin B1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pmc09569496-253-64-67?v=R%26D+Systems
Average 92 stars, based on 1 article reviews
pab cyclin b1 - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

90
OriGene murine cyclin b1 cdna
Figure 1. <t>Cyclin</t> <t>B1</t> protein and RNA are reduced during MVM infection. (A) Murine A9
Murine Cyclin B1 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/10__1128_slash_jvi__00428___17-80-0-8?v=OriGene
Average 90 stars, based on 1 article reviews
murine cyclin b1 cdna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
OriGene wild type cyclin b1 cdna
Figure 1. <t>Cyclin</t> <t>B1</t> protein and RNA are reduced during MVM infection. (A) Murine A9
Wild Type Cyclin B1 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/10__1128_slash_jvi__00428___17-62-5-9?v=OriGene
Average 90 stars, based on 1 article reviews
wild type cyclin b1 cdna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Novus Biologicals rabbit anti human cyclin e antibody
Figure 1. <t>Cyclin</t> <t>B1</t> protein and RNA are reduced during MVM infection. (A) Murine A9
Rabbit Anti Human Cyclin E Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pmc05859078-165-14-22?v=Novus+Biologicals
Average 93 stars, based on 1 article reviews
rabbit anti human cyclin e antibody - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
R&D Systems af6000
Figure 1. <t>Cyclin</t> <t>B1</t> protein and RNA are reduced during MVM infection. (A) Murine A9
Af6000, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pmc07518282-235-142-140?v=R%26D+Systems
Average 93 stars, based on 1 article reviews
af6000 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
R&D Systems monoclonal rabbit anti tgf b1 antibody
Fig. 6. Western blot analysis of <t>TGF-b1</t> protein expression in HK- 2 cells. Cells were treated with varying concentrations of CsA for 48 h. Proteins were run on a 12% SDS–PAGE gel. Levels of TGF- b1 were detected by western blotting. Bands corresponding to the molecular weight of TGF b (25 kDa) were detected as shown by arrow. (a) Western blot of TGF-b1. The blot is representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as % control at time zero and are given as the mean ± SEM of three independent experiments each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001.
Monoclonal Rabbit Anti Tgf B1 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pm16030052-93-25-29?v=R%26D+Systems
Average 90 stars, based on 1 article reviews
monoclonal rabbit anti tgf b1 antibody - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Becton Dickinson mouse anti-human cyclin b1 antibody (gns-11; 1:500)
Fig. 6. Western blot analysis of <t>TGF-b1</t> protein expression in HK- 2 cells. Cells were treated with varying concentrations of CsA for 48 h. Proteins were run on a 12% SDS–PAGE gel. Levels of TGF- b1 were detected by western blotting. Bands corresponding to the molecular weight of TGF b (25 kDa) were detected as shown by arrow. (a) Western blot of TGF-b1. The blot is representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as % control at time zero and are given as the mean ± SEM of three independent experiments each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001.
Mouse Anti Human Cyclin B1 Antibody (Gns 11; 1:500), supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/10__1128_slash_mcb__25__24__10875___10894__2005-108-59-66?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
mouse anti-human cyclin b1 antibody (gns-11; 1:500) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenScript corporation dna fragments encoding the n-terminal 124 amino acids of wild-type human cyclin b1
Ubiquitin vinyl sulfone (UbVS) inhibits <t>cyclin</t> <t>B1</t> degradation by depleting available ubiquitin. ( a ) 35 S-labeled cycB1-NT and 20 or 44 μM of wild-type (WT) Ub were introduced into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( b ) Wild-type ubiquitin or forms of ubiquitin (44 μM) bearing single-point mutations in distinct interaction surfaces on ubiquitin, along with radiolabeled substrate, were added to UbVS-treated extract. For panels ( c – e ), mitotically-arrested Xenopus extract was pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Wild-type ubiquitin (44 μM) was added to extract, as indicated. Aliquots were withdrawn at indicated times and analyzed by SDS-PAGE and western blot. ( c ) Ubiquitin status in Xenopus extract was examined by anti-ubiquitin western blot. ( d ) Levels of Ub-charged endogenous UBCH10 were examined by anti-UBCH10 western blot. Aliquots were removed at the indicated times and quenched with either nonreducing sample buffer to examine levels of UBCH10~Ub or reducing sample buffer to examine total levels of UBCH10. ( e ) Same as in d , but levels of endogenous ubiquitin-charged UBCH5 were examined by western blot. Uncropped images of immunoblots are presented in
Dna Fragments Encoding The N Terminal 124 Amino Acids Of Wild Type Human Cyclin B1, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pmc03278798-150-4-45?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
dna fragments encoding the n-terminal 124 amino acids of wild-type human cyclin b1 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Becton Dickinson human cyclin b1 (554176)
Ubiquitin vinyl sulfone (UbVS) inhibits <t>cyclin</t> <t>B1</t> degradation by depleting available ubiquitin. ( a ) 35 S-labeled cycB1-NT and 20 or 44 μM of wild-type (WT) Ub were introduced into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( b ) Wild-type ubiquitin or forms of ubiquitin (44 μM) bearing single-point mutations in distinct interaction surfaces on ubiquitin, along with radiolabeled substrate, were added to UbVS-treated extract. For panels ( c – e ), mitotically-arrested Xenopus extract was pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Wild-type ubiquitin (44 μM) was added to extract, as indicated. Aliquots were withdrawn at indicated times and analyzed by SDS-PAGE and western blot. ( c ) Ubiquitin status in Xenopus extract was examined by anti-ubiquitin western blot. ( d ) Levels of Ub-charged endogenous UBCH10 were examined by anti-UBCH10 western blot. Aliquots were removed at the indicated times and quenched with either nonreducing sample buffer to examine levels of UBCH10~Ub or reducing sample buffer to examine total levels of UBCH10. ( e ) Same as in d , but levels of endogenous ubiquitin-charged UBCH5 were examined by western blot. Uncropped images of immunoblots are presented in
Human Cyclin B1 (554176), supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pm20655412-123-19-31?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
human cyclin b1 (554176) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Becton Dickinson fluorescein-conjugated mouse anti-human cyclin b1 antibody
Ubiquitin vinyl sulfone (UbVS) inhibits <t>cyclin</t> <t>B1</t> degradation by depleting available ubiquitin. ( a ) 35 S-labeled cycB1-NT and 20 or 44 μM of wild-type (WT) Ub were introduced into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( b ) Wild-type ubiquitin or forms of ubiquitin (44 μM) bearing single-point mutations in distinct interaction surfaces on ubiquitin, along with radiolabeled substrate, were added to UbVS-treated extract. For panels ( c – e ), mitotically-arrested Xenopus extract was pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Wild-type ubiquitin (44 μM) was added to extract, as indicated. Aliquots were withdrawn at indicated times and analyzed by SDS-PAGE and western blot. ( c ) Ubiquitin status in Xenopus extract was examined by anti-ubiquitin western blot. ( d ) Levels of Ub-charged endogenous UBCH10 were examined by anti-UBCH10 western blot. Aliquots were removed at the indicated times and quenched with either nonreducing sample buffer to examine levels of UBCH10~Ub or reducing sample buffer to examine total levels of UBCH10. ( e ) Same as in d , but levels of endogenous ubiquitin-charged UBCH5 were examined by western blot. Uncropped images of immunoblots are presented in
Fluorescein Conjugated Mouse Anti Human Cyclin B1 Antibody, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pmc02650675-151-17-24?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
fluorescein-conjugated mouse anti-human cyclin b1 antibody - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
ImmunoGen Inc recombinant human cyclin b1 protein(1-150aa)
Ubiquitin vinyl sulfone (UbVS) inhibits <t>cyclin</t> <t>B1</t> degradation by depleting available ubiquitin. ( a ) 35 S-labeled cycB1-NT and 20 or 44 μM of wild-type (WT) Ub were introduced into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( b ) Wild-type ubiquitin or forms of ubiquitin (44 μM) bearing single-point mutations in distinct interaction surfaces on ubiquitin, along with radiolabeled substrate, were added to UbVS-treated extract. For panels ( c – e ), mitotically-arrested Xenopus extract was pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Wild-type ubiquitin (44 μM) was added to extract, as indicated. Aliquots were withdrawn at indicated times and analyzed by SDS-PAGE and western blot. ( c ) Ubiquitin status in Xenopus extract was examined by anti-ubiquitin western blot. ( d ) Levels of Ub-charged endogenous UBCH10 were examined by anti-UBCH10 western blot. Aliquots were removed at the indicated times and quenched with either nonreducing sample buffer to examine levels of UBCH10~Ub or reducing sample buffer to examine total levels of UBCH10. ( e ) Same as in d , but levels of endogenous ubiquitin-charged UBCH5 were examined by western blot. Uncropped images of immunoblots are presented in
Recombinant Human Cyclin B1 Protein(1 150aa), supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pmc09278077__mmc5-474-19-17?v=ImmunoGen+Inc
Average 90 stars, based on 1 article reviews
recombinant human cyclin b1 protein(1-150aa) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Becton Dickinson anti-human cyclin b1
Independence of PIM1 expression and cell cycle arrest. A, DNA histogram analysis of RWPE-2 cells after docetaxel 10 or 100 nm treatments for 24 h. sG1, a sub-G1 cell population with less than 2 n DNA content. G1 and G2, the appearance of cells in G0/G1 or G2/M phases of the cell cycle. B, immunoblot analysis of <t>cyclin</t> <t>B1</t> and PIM1 expression after docetaxel 10 nm (B, left) or 100 nm (B, right) treatment at various time points.
Anti Human Cyclin B1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+cyclin+b1/pmc03258959-37-51-56?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
anti-human cyclin b1 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Interaction analysis of TB40-IE2-YFP ORF-UL97 resistance mutants with human cyclins. HFFs in T75 flasks were infected with HCMV TB40-IE2-YFP WT or newly generated ORF-UL97 point mutants. Cells were harvested between 4 and 7 d.p.i., when approximately 80% of the cells showed a cytopathic effect. Cells were lysed, and human cyclins T1 ( A ), H ( B ), and B1 ( C ) were immunoprecipitated using specific antibodies. A chicken Fc fragment served as specificity control, and lysate taken prior to immunoprecipitation was used as input control. All samples were subjected to Wb analysis, and proteins were detected using specific monoclonal and polyclonal antibodies. ( D ) A summary is given of biological replicates (Rep1, Rep2, Rep3) monitoring the interaction of pUL97 mutants with human cyclins T1, H, and B1.

Journal: International Journal of Molecular Sciences

Article Title: Highly Conserved Interaction Profiles between Clinically Relevant Mutants of the Cytomegalovirus CDK-like Kinase pUL97 and Human Cyclins: Functional Significance of Cyclin H

doi: 10.3390/ijms231911814

Figure Lengend Snippet: Interaction analysis of TB40-IE2-YFP ORF-UL97 resistance mutants with human cyclins. HFFs in T75 flasks were infected with HCMV TB40-IE2-YFP WT or newly generated ORF-UL97 point mutants. Cells were harvested between 4 and 7 d.p.i., when approximately 80% of the cells showed a cytopathic effect. Cells were lysed, and human cyclins T1 ( A ), H ( B ), and B1 ( C ) were immunoprecipitated using specific antibodies. A chicken Fc fragment served as specificity control, and lysate taken prior to immunoprecipitation was used as input control. All samples were subjected to Wb analysis, and proteins were detected using specific monoclonal and polyclonal antibodies. ( D ) A summary is given of biological replicates (Rep1, Rep2, Rep3) monitoring the interaction of pUL97 mutants with human cyclins T1, H, and B1.

Article Snippet: The following antibodies were used for this study [ ]: mAb-UL97.01 (kindly provided by T. Lenac and S. Jonick; Department of Histology and Embryology, University of Rijeka, Croatia, used for Wb analysis), pAb-UL97 (kindly provided by D. M. Coen, Harvard Medical School, Boston, used for Wb analysis), mAb-β-Actin (A5441, Sigma Aldrich, used for Wb analysis), mAb-Cyclin B1 (sc-245, Santa Cruz, used for Wb analysis), pAb-Cyclin B1 (AF6000, R&D Systems, used for IP and Wb analysis), pAb-Cyclin T1 (ab226851, abcam, used for IP and Wb analysis), pAb-Cyclin H (LS-C331195, LS Bio, used for IP and Wb analysis), and Fc chicken (003-000-008, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA).

Techniques: Infection, Generated, Immunoprecipitation, Control

Interaction analysis of AD169 pUL97 resistance mutants with human cyclins. HFFs in T75 flasks were infected with HCMV AD169 WT or UL97 point mutants (UL97 WT and mutants were derived from Sunwen Chou, Portland, OR, USA). Cells were harvested between 4 and 7 d.p.i., when approx. 80% of the cells showed a cytopathic effect. Cells were lysed, and human cyclins T1 ( A ), H ( B ), and B1 ( C ) were immunoprecipitated using specific antibodies. A chicken Fc fragment served as specificity control, and lysate taken prior to immunoprecipitation was used as input control. All samples were subjected to Wb analysis, and proteins were detected using the specific monoclonal and polyclonal antibodies indicated.

Journal: International Journal of Molecular Sciences

Article Title: Highly Conserved Interaction Profiles between Clinically Relevant Mutants of the Cytomegalovirus CDK-like Kinase pUL97 and Human Cyclins: Functional Significance of Cyclin H

doi: 10.3390/ijms231911814

Figure Lengend Snippet: Interaction analysis of AD169 pUL97 resistance mutants with human cyclins. HFFs in T75 flasks were infected with HCMV AD169 WT or UL97 point mutants (UL97 WT and mutants were derived from Sunwen Chou, Portland, OR, USA). Cells were harvested between 4 and 7 d.p.i., when approx. 80% of the cells showed a cytopathic effect. Cells were lysed, and human cyclins T1 ( A ), H ( B ), and B1 ( C ) were immunoprecipitated using specific antibodies. A chicken Fc fragment served as specificity control, and lysate taken prior to immunoprecipitation was used as input control. All samples were subjected to Wb analysis, and proteins were detected using the specific monoclonal and polyclonal antibodies indicated.

Article Snippet: The following antibodies were used for this study [ ]: mAb-UL97.01 (kindly provided by T. Lenac and S. Jonick; Department of Histology and Embryology, University of Rijeka, Croatia, used for Wb analysis), pAb-UL97 (kindly provided by D. M. Coen, Harvard Medical School, Boston, used for Wb analysis), mAb-β-Actin (A5441, Sigma Aldrich, used for Wb analysis), mAb-Cyclin B1 (sc-245, Santa Cruz, used for Wb analysis), pAb-Cyclin B1 (AF6000, R&D Systems, used for IP and Wb analysis), pAb-Cyclin T1 (ab226851, abcam, used for IP and Wb analysis), pAb-Cyclin H (LS-C331195, LS Bio, used for IP and Wb analysis), and Fc chicken (003-000-008, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA).

Techniques: Infection, Derivative Assay, Immunoprecipitation, Control

Interaction analysis with human cyclins, and viral replication kinetics of HCMV ORF-UL97 deletion mutants within the amino acid region 231-280. ( A ) A schematic depiction of newly generated HCMV ORF-UL97 deletion mutants in fragments of amino acids 231-280. ( B ) HFFs in T175 flasks were infected with HCMV AD169 WT, ORF-UL97 mutant versions, or remained mock-infected. Cells were harvested and lysed 4 d.p.i. Lysate control samples were taken before human cyclins H and T1 were immunoprecipitated using the specific antibodies indicated. A chicken Fc fragment served as negative control. All samples were subjected to Wb analysis, and proteins were detected using specific monoclonal and polyclonal antibodies as indicated below the panels. ( C ) A total of 225,000 HFFs in 12-well plates were infected with parental HCMV strain AD169-GFP WT or ORF-UL97 deletion mutants at a viral dose of 1 × 10 5 genome copies. Viral supernatants were harvested at indicated time points and viral genome equivalents were determined by qPCR. Each value represents the mean ± SD of two independent biological replicates, each measured twice. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; ****, p < 0.0001.

Journal: International Journal of Molecular Sciences

Article Title: Highly Conserved Interaction Profiles between Clinically Relevant Mutants of the Cytomegalovirus CDK-like Kinase pUL97 and Human Cyclins: Functional Significance of Cyclin H

doi: 10.3390/ijms231911814

Figure Lengend Snippet: Interaction analysis with human cyclins, and viral replication kinetics of HCMV ORF-UL97 deletion mutants within the amino acid region 231-280. ( A ) A schematic depiction of newly generated HCMV ORF-UL97 deletion mutants in fragments of amino acids 231-280. ( B ) HFFs in T175 flasks were infected with HCMV AD169 WT, ORF-UL97 mutant versions, or remained mock-infected. Cells were harvested and lysed 4 d.p.i. Lysate control samples were taken before human cyclins H and T1 were immunoprecipitated using the specific antibodies indicated. A chicken Fc fragment served as negative control. All samples were subjected to Wb analysis, and proteins were detected using specific monoclonal and polyclonal antibodies as indicated below the panels. ( C ) A total of 225,000 HFFs in 12-well plates were infected with parental HCMV strain AD169-GFP WT or ORF-UL97 deletion mutants at a viral dose of 1 × 10 5 genome copies. Viral supernatants were harvested at indicated time points and viral genome equivalents were determined by qPCR. Each value represents the mean ± SD of two independent biological replicates, each measured twice. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; ****, p < 0.0001.

Article Snippet: The following antibodies were used for this study [ ]: mAb-UL97.01 (kindly provided by T. Lenac and S. Jonick; Department of Histology and Embryology, University of Rijeka, Croatia, used for Wb analysis), pAb-UL97 (kindly provided by D. M. Coen, Harvard Medical School, Boston, used for Wb analysis), mAb-β-Actin (A5441, Sigma Aldrich, used for Wb analysis), mAb-Cyclin B1 (sc-245, Santa Cruz, used for Wb analysis), pAb-Cyclin B1 (AF6000, R&D Systems, used for IP and Wb analysis), pAb-Cyclin T1 (ab226851, abcam, used for IP and Wb analysis), pAb-Cyclin H (LS-C331195, LS Bio, used for IP and Wb analysis), and Fc chicken (003-000-008, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA).

Techniques: Generated, Infection, Mutagenesis, Control, Immunoprecipitation, Negative Control

HCMV AD169-GFP replication kinetics in HFF WT and cyclin B1/T1 KO populations. HFFs were infected with HCMV AD169. Viral replication kinetics were determined by collecting viral supernatants at the indicated time points, and viral genome equivalents were determined by qPCR. Each value represents the mean ± SD of two independent biological replicates, each measured twice: ( A ) replication kinetics obtained for cyclin B1 KO cell populations A and B compared to WT (MOI 0.025); ( C ) replication kinetics obtained for cyclin T1 KO cell populations A, B and C compared to WT (MOI 0.01); ( B , D ) effectivity of cyclin B1 KO (cell populations A and B) and cyclin T1 KO (cell populations A, B and C), respectively, was verified by standard SDS-PAGE and Wb analysis using specific antibodies as indicated.

Journal: International Journal of Molecular Sciences

Article Title: Highly Conserved Interaction Profiles between Clinically Relevant Mutants of the Cytomegalovirus CDK-like Kinase pUL97 and Human Cyclins: Functional Significance of Cyclin H

doi: 10.3390/ijms231911814

Figure Lengend Snippet: HCMV AD169-GFP replication kinetics in HFF WT and cyclin B1/T1 KO populations. HFFs were infected with HCMV AD169. Viral replication kinetics were determined by collecting viral supernatants at the indicated time points, and viral genome equivalents were determined by qPCR. Each value represents the mean ± SD of two independent biological replicates, each measured twice: ( A ) replication kinetics obtained for cyclin B1 KO cell populations A and B compared to WT (MOI 0.025); ( C ) replication kinetics obtained for cyclin T1 KO cell populations A, B and C compared to WT (MOI 0.01); ( B , D ) effectivity of cyclin B1 KO (cell populations A and B) and cyclin T1 KO (cell populations A, B and C), respectively, was verified by standard SDS-PAGE and Wb analysis using specific antibodies as indicated.

Article Snippet: The following antibodies were used for this study [ ]: mAb-UL97.01 (kindly provided by T. Lenac and S. Jonick; Department of Histology and Embryology, University of Rijeka, Croatia, used for Wb analysis), pAb-UL97 (kindly provided by D. M. Coen, Harvard Medical School, Boston, used for Wb analysis), mAb-β-Actin (A5441, Sigma Aldrich, used for Wb analysis), mAb-Cyclin B1 (sc-245, Santa Cruz, used for Wb analysis), pAb-Cyclin B1 (AF6000, R&D Systems, used for IP and Wb analysis), pAb-Cyclin T1 (ab226851, abcam, used for IP and Wb analysis), pAb-Cyclin H (LS-C331195, LS Bio, used for IP and Wb analysis), and Fc chicken (003-000-008, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA).

Techniques: Infection, SDS Page

HCMV AD169-GFP replication kinetics in HFF WT and in transiently transduced HFFs with a partial level of cyclin H KO. A total of 225,000 HFFs were seeded in 12-well plates. The next day, cells were incubated with lentiviral supernatant for 24 h, introducing the CRISPR/Cas9 system and a cocktail of cyclin H-specific gRNAs for transient transduction. Subsequently, cells were incubated with fresh medium for 24 h. Next, HFF WT and cyclin H KO populations were infected with HCMV AD169-GFP at an MOI of 0.5 and harvested at the indicated time points. ( A ) Cells were lysed and the GFP signal of lysates was measured in triplicate using a Victor multilabel reader. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; ****, p < 0.0001. ( B ) For comparison of intracellular cyclin H expression levels, the total cellular lysates used for GFP signal quantitation were subsequently denatured at the indicated time points and used for standard SDS-PAGE and Wb analysis. Cyclin H and β-actin were detected using specific antibodies as indicated.

Journal: International Journal of Molecular Sciences

Article Title: Highly Conserved Interaction Profiles between Clinically Relevant Mutants of the Cytomegalovirus CDK-like Kinase pUL97 and Human Cyclins: Functional Significance of Cyclin H

doi: 10.3390/ijms231911814

Figure Lengend Snippet: HCMV AD169-GFP replication kinetics in HFF WT and in transiently transduced HFFs with a partial level of cyclin H KO. A total of 225,000 HFFs were seeded in 12-well plates. The next day, cells were incubated with lentiviral supernatant for 24 h, introducing the CRISPR/Cas9 system and a cocktail of cyclin H-specific gRNAs for transient transduction. Subsequently, cells were incubated with fresh medium for 24 h. Next, HFF WT and cyclin H KO populations were infected with HCMV AD169-GFP at an MOI of 0.5 and harvested at the indicated time points. ( A ) Cells were lysed and the GFP signal of lysates was measured in triplicate using a Victor multilabel reader. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; ****, p < 0.0001. ( B ) For comparison of intracellular cyclin H expression levels, the total cellular lysates used for GFP signal quantitation were subsequently denatured at the indicated time points and used for standard SDS-PAGE and Wb analysis. Cyclin H and β-actin were detected using specific antibodies as indicated.

Article Snippet: The following antibodies were used for this study [ ]: mAb-UL97.01 (kindly provided by T. Lenac and S. Jonick; Department of Histology and Embryology, University of Rijeka, Croatia, used for Wb analysis), pAb-UL97 (kindly provided by D. M. Coen, Harvard Medical School, Boston, used for Wb analysis), mAb-β-Actin (A5441, Sigma Aldrich, used for Wb analysis), mAb-Cyclin B1 (sc-245, Santa Cruz, used for Wb analysis), pAb-Cyclin B1 (AF6000, R&D Systems, used for IP and Wb analysis), pAb-Cyclin T1 (ab226851, abcam, used for IP and Wb analysis), pAb-Cyclin H (LS-C331195, LS Bio, used for IP and Wb analysis), and Fc chicken (003-000-008, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA).

Techniques: Incubation, CRISPR, Transduction, Infection, Comparison, Expressing, Quantitation Assay, SDS Page

Application of the qSox-IVKA for quantitative measurement of in vitro pUL97 kinase activity. The 293T cells were seeded in 10-cm 2 dishes for transfection on the following day using plasmids coding for pUL97-Flag or empty vector control. At 1 day post-transfection (d.p.t.), cells were lysed and pUL97-Flag was immunoprecipitated using 25 µL Dynabeads ® protein A coupled with Flag-tag specific antibodies. Dynabead-bound proteins were then eluted in 50 µL enzyme buffer and used for qSox-IVKA. For these reactions, 40 µL of kinase reaction mix was pipetted in Corning NBS 96-well half area microplates, before 10 µL Dynabeads protein solution was added. Kinase activity was measured using a Victor multilabel reader, at every 30 s of the kinetics for approximately 80 min. Values of pUL97 activity were normalized according to the expression levels on Wbs. ( A ) Absolute values of the measured RFUs for pUL97 and vector control, as treated with 5 µM of MBV or DMSO as the solvent control; measurements were performed in duplicate. ( B ) Empty vector controls from panel A were used for normalization of pUL97 signal intensities, to depict the specific activity. ( C ) The pUL97 kinase activity was determined by qSox-IVKA under conditions with or without cyclin H-HA coexpression (transient cotransfection setting); mean values of duplicates are given. ( D ) Relative pUL97 + cyclin H activity per min was calculated for the linear proportion of the curve obtained in panel C for 20–70 min, normalized to pUL97 + vector control. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; **, p < 0.01. ( E ) Mutant kinase activity of construct pUL97 Δ231-280 was compared with pUL97 WT (both Flag-tagged), by qSox-IVKA. Mean values are given of two independent experiments, with measurements taken in duplicate. ( F ) Relative pUL97 activity per minute was calculated for the linear proportion of the curve obtained in panel E for 20–60 min, normalized to pUL97-Flag. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; *, p < 0.05.

Journal: International Journal of Molecular Sciences

Article Title: Highly Conserved Interaction Profiles between Clinically Relevant Mutants of the Cytomegalovirus CDK-like Kinase pUL97 and Human Cyclins: Functional Significance of Cyclin H

doi: 10.3390/ijms231911814

Figure Lengend Snippet: Application of the qSox-IVKA for quantitative measurement of in vitro pUL97 kinase activity. The 293T cells were seeded in 10-cm 2 dishes for transfection on the following day using plasmids coding for pUL97-Flag or empty vector control. At 1 day post-transfection (d.p.t.), cells were lysed and pUL97-Flag was immunoprecipitated using 25 µL Dynabeads ® protein A coupled with Flag-tag specific antibodies. Dynabead-bound proteins were then eluted in 50 µL enzyme buffer and used for qSox-IVKA. For these reactions, 40 µL of kinase reaction mix was pipetted in Corning NBS 96-well half area microplates, before 10 µL Dynabeads protein solution was added. Kinase activity was measured using a Victor multilabel reader, at every 30 s of the kinetics for approximately 80 min. Values of pUL97 activity were normalized according to the expression levels on Wbs. ( A ) Absolute values of the measured RFUs for pUL97 and vector control, as treated with 5 µM of MBV or DMSO as the solvent control; measurements were performed in duplicate. ( B ) Empty vector controls from panel A were used for normalization of pUL97 signal intensities, to depict the specific activity. ( C ) The pUL97 kinase activity was determined by qSox-IVKA under conditions with or without cyclin H-HA coexpression (transient cotransfection setting); mean values of duplicates are given. ( D ) Relative pUL97 + cyclin H activity per min was calculated for the linear proportion of the curve obtained in panel C for 20–70 min, normalized to pUL97 + vector control. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; **, p < 0.01. ( E ) Mutant kinase activity of construct pUL97 Δ231-280 was compared with pUL97 WT (both Flag-tagged), by qSox-IVKA. Mean values are given of two independent experiments, with measurements taken in duplicate. ( F ) Relative pUL97 activity per minute was calculated for the linear proportion of the curve obtained in panel E for 20–60 min, normalized to pUL97-Flag. Statistical analysis was performed using an ordinary two-way ANOVA and post-hoc Sidak correction; *, p < 0.05.

Article Snippet: The following antibodies were used for this study [ ]: mAb-UL97.01 (kindly provided by T. Lenac and S. Jonick; Department of Histology and Embryology, University of Rijeka, Croatia, used for Wb analysis), pAb-UL97 (kindly provided by D. M. Coen, Harvard Medical School, Boston, used for Wb analysis), mAb-β-Actin (A5441, Sigma Aldrich, used for Wb analysis), mAb-Cyclin B1 (sc-245, Santa Cruz, used for Wb analysis), pAb-Cyclin B1 (AF6000, R&D Systems, used for IP and Wb analysis), pAb-Cyclin T1 (ab226851, abcam, used for IP and Wb analysis), pAb-Cyclin H (LS-C331195, LS Bio, used for IP and Wb analysis), and Fc chicken (003-000-008, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA).

Techniques: In Vitro, Activity Assay, Transfection, Plasmid Preparation, Control, Immunoprecipitation, FLAG-tag, Expressing, Solvent, Cotransfection, Mutagenesis, Construct

Viral characteristics relating to  pUL97-cyclin  interaction.

Journal: International Journal of Molecular Sciences

Article Title: Highly Conserved Interaction Profiles between Clinically Relevant Mutants of the Cytomegalovirus CDK-like Kinase pUL97 and Human Cyclins: Functional Significance of Cyclin H

doi: 10.3390/ijms231911814

Figure Lengend Snippet: Viral characteristics relating to pUL97-cyclin interaction.

Article Snippet: The following antibodies were used for this study [ ]: mAb-UL97.01 (kindly provided by T. Lenac and S. Jonick; Department of Histology and Embryology, University of Rijeka, Croatia, used for Wb analysis), pAb-UL97 (kindly provided by D. M. Coen, Harvard Medical School, Boston, used for Wb analysis), mAb-β-Actin (A5441, Sigma Aldrich, used for Wb analysis), mAb-Cyclin B1 (sc-245, Santa Cruz, used for Wb analysis), pAb-Cyclin B1 (AF6000, R&D Systems, used for IP and Wb analysis), pAb-Cyclin T1 (ab226851, abcam, used for IP and Wb analysis), pAb-Cyclin H (LS-C331195, LS Bio, used for IP and Wb analysis), and Fc chicken (003-000-008, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA).

Techniques: Activity Assay, Virus, Mutagenesis

Figure 1. Cyclin B1 protein and RNA are reduced during MVM infection. (A) Murine A9

Journal: Journal of Virology

Article Title: Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection

doi: 10.1128/jvi.00428-17

Figure Lengend Snippet: Figure 1. Cyclin B1 protein and RNA are reduced during MVM infection. (A) Murine A9

Article Snippet: Murine cyclin B1 cDNA was obtained from 188 Origene.

Techniques: Infection

Figure 2. Cyclin B1 driven from a heterologous promoter and 3’UTR is stable during MVM

Journal: Journal of Virology

Article Title: Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection

doi: 10.1128/jvi.00428-17

Figure Lengend Snippet: Figure 2. Cyclin B1 driven from a heterologous promoter and 3’UTR is stable during MVM

Article Snippet: Murine cyclin B1 cDNA was obtained from 188 Origene.

Techniques:

Figure 3. MVM infection reduces occupancy of RNA polymerase II on the cyclin B1

Journal: Journal of Virology

Article Title: Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection

doi: 10.1128/jvi.00428-17

Figure Lengend Snippet: Figure 3. MVM infection reduces occupancy of RNA polymerase II on the cyclin B1

Article Snippet: Murine cyclin B1 cDNA was obtained from 188 Origene.

Techniques: Infection

Figure 1. Cyclin B1 protein and RNA are reduced during MVM infection. (A) Murine A9

Journal: Journal of Virology

Article Title: Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection

doi: 10.1128/jvi.00428-17

Figure Lengend Snippet: Figure 1. Cyclin B1 protein and RNA are reduced during MVM infection. (A) Murine A9

Article Snippet: 147 148 Plasmids 149 Murine wild-type Cyclin B1 cDNA (Origene) was cloned into p3XFLAG-CMV 7.1 150 (Sigma).

Techniques: Infection

Figure 2. Cyclin B1 driven from a heterologous promoter and 3’UTR is stable during MVM

Journal: Journal of Virology

Article Title: Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection

doi: 10.1128/jvi.00428-17

Figure Lengend Snippet: Figure 2. Cyclin B1 driven from a heterologous promoter and 3’UTR is stable during MVM

Article Snippet: 147 148 Plasmids 149 Murine wild-type Cyclin B1 cDNA (Origene) was cloned into p3XFLAG-CMV 7.1 150 (Sigma).

Techniques:

Figure 3. MVM infection reduces occupancy of RNA polymerase II on the cyclin B1

Journal: Journal of Virology

Article Title: Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection

doi: 10.1128/jvi.00428-17

Figure Lengend Snippet: Figure 3. MVM infection reduces occupancy of RNA polymerase II on the cyclin B1

Article Snippet: 147 148 Plasmids 149 Murine wild-type Cyclin B1 cDNA (Origene) was cloned into p3XFLAG-CMV 7.1 150 (Sigma).

Techniques: Infection

Fig. 6. Western blot analysis of TGF-b1 protein expression in HK- 2 cells. Cells were treated with varying concentrations of CsA for 48 h. Proteins were run on a 12% SDS–PAGE gel. Levels of TGF- b1 were detected by western blotting. Bands corresponding to the molecular weight of TGF b (25 kDa) were detected as shown by arrow. (a) Western blot of TGF-b1. The blot is representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as % control at time zero and are given as the mean ± SEM of three independent experiments each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001.

Journal: Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association

Article Title: Cyclosporine A induced epithelial-mesenchymal transition in human renal proximal tubular epithelial cells.

doi: 10.1093/ndt/gfh967

Figure Lengend Snippet: Fig. 6. Western blot analysis of TGF-b1 protein expression in HK- 2 cells. Cells were treated with varying concentrations of CsA for 48 h. Proteins were run on a 12% SDS–PAGE gel. Levels of TGF- b1 were detected by western blotting. Bands corresponding to the molecular weight of TGF b (25 kDa) were detected as shown by arrow. (a) Western blot of TGF-b1. The blot is representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as % control at time zero and are given as the mean ± SEM of three independent experiments each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001.

Article Snippet: The blots were blocked for 1 h at room temperature in 5% milk proteins/TBS and were incubated overnight at 4 C with 1 : 1000 monoclonal (rabbit) anti-TGF-b1 antibody (R&D systems).

Techniques: Western Blot, Expressing, SDS Page, Molecular Weight, Control

Fig. 7. Comparison of the effect of the addition of CsA±TGF-b1 neutralizing antibody to HK-2 cellular morphology. HK-2 cells were treated at confluency for 48 h with 4.2 mM CsA±pre-treatment with 30 mg/ml of TGF-b1 neutralizing antibody. The cells were pre-treated with the neutralizing antibody for 1 h prior to CsA treatment or were treated with CsA alone for various time points. Cells were visualized using phase contrast microscopy. The pictures are representative of at least three independent experiments performed in duplicate. Arrows indicates the presence of elongation/filopodia. Original magnification, 200. Calibration bar, 10 mm.

Journal: Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association

Article Title: Cyclosporine A induced epithelial-mesenchymal transition in human renal proximal tubular epithelial cells.

doi: 10.1093/ndt/gfh967

Figure Lengend Snippet: Fig. 7. Comparison of the effect of the addition of CsA±TGF-b1 neutralizing antibody to HK-2 cellular morphology. HK-2 cells were treated at confluency for 48 h with 4.2 mM CsA±pre-treatment with 30 mg/ml of TGF-b1 neutralizing antibody. The cells were pre-treated with the neutralizing antibody for 1 h prior to CsA treatment or were treated with CsA alone for various time points. Cells were visualized using phase contrast microscopy. The pictures are representative of at least three independent experiments performed in duplicate. Arrows indicates the presence of elongation/filopodia. Original magnification, 200. Calibration bar, 10 mm.

Article Snippet: The blots were blocked for 1 h at room temperature in 5% milk proteins/TBS and were incubated overnight at 4 C with 1 : 1000 monoclonal (rabbit) anti-TGF-b1 antibody (R&D systems).

Techniques: Comparison, Microscopy

Fig. 9. (a) Influence of TGF-b1 neutralizing antibody on cyclosporine abrogation of E-cadherin gene expression in HK-2 cells. Cells were grown to confluency on 35 mm Petri dishes and treated with 4.2 mM CsA with or without TGF-b1 neutralizing antibody. TGF-b1 neutralizing antibody was diluted in culture medium to a concentration of 30 mg/ml. The cells were pre-treated with the neutralizing antibody for 1 h prior to CsA treatment or were treated with CsA alone for 48 h. E-cadherin and GAPDH mRNA levels were analysed in total RNA purified from the treated HK-2 cells. (a) Ethidium bromide-stained 1% agarose gels containing 10 ml of each PCR after electrophoresis. Treatments were 4.2 and 42 mM CsA for 48 h. The pictures are representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as relative optical density units, which are proportional to the absorbance of the bands and are given as mean ± SEM of three independent experiments, each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001. (b) Influence of TGF-b1 neutralizing antibody on CsA induction of a-SMA gene expression in HK-2 cells. Cells were grown to confluency on 35 mm Petri dishes and treated with 4.2 and 42 mM CsA with or without TGF-b1 neutralizing antibody. TGF-b1 neutralizing antibody was diluted in culture medium to a concentration of 30 mg/ml. The cells were pre- treated with the neutralizing antibody for 1 h prior to CsA treatment or were treated with CsA alone for48 h. a-SMA and GAPDH mRNA levels were analysed in total RNA purified from the treated HK-2 cells. (a) Ethidium bromide-stained 1% agarose gels containing 10 ml of each PCR after electrophoresis. Treatments were 4.2 and 42 mM CsA for 48 h. The pictures are representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as relative optical density units, which are proportional to the absorbance of the bands and are given as mean ± SEM of three independent experiments, each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001.

Journal: Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association

Article Title: Cyclosporine A induced epithelial-mesenchymal transition in human renal proximal tubular epithelial cells.

doi: 10.1093/ndt/gfh967

Figure Lengend Snippet: Fig. 9. (a) Influence of TGF-b1 neutralizing antibody on cyclosporine abrogation of E-cadherin gene expression in HK-2 cells. Cells were grown to confluency on 35 mm Petri dishes and treated with 4.2 mM CsA with or without TGF-b1 neutralizing antibody. TGF-b1 neutralizing antibody was diluted in culture medium to a concentration of 30 mg/ml. The cells were pre-treated with the neutralizing antibody for 1 h prior to CsA treatment or were treated with CsA alone for 48 h. E-cadherin and GAPDH mRNA levels were analysed in total RNA purified from the treated HK-2 cells. (a) Ethidium bromide-stained 1% agarose gels containing 10 ml of each PCR after electrophoresis. Treatments were 4.2 and 42 mM CsA for 48 h. The pictures are representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as relative optical density units, which are proportional to the absorbance of the bands and are given as mean ± SEM of three independent experiments, each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001. (b) Influence of TGF-b1 neutralizing antibody on CsA induction of a-SMA gene expression in HK-2 cells. Cells were grown to confluency on 35 mm Petri dishes and treated with 4.2 and 42 mM CsA with or without TGF-b1 neutralizing antibody. TGF-b1 neutralizing antibody was diluted in culture medium to a concentration of 30 mg/ml. The cells were pre- treated with the neutralizing antibody for 1 h prior to CsA treatment or were treated with CsA alone for48 h. a-SMA and GAPDH mRNA levels were analysed in total RNA purified from the treated HK-2 cells. (a) Ethidium bromide-stained 1% agarose gels containing 10 ml of each PCR after electrophoresis. Treatments were 4.2 and 42 mM CsA for 48 h. The pictures are representative of at least three independent experiments performed in duplicate. (b) Band intensity was quantified using densitometry. Results are expressed as relative optical density units, which are proportional to the absorbance of the bands and are given as mean ± SEM of three independent experiments, each performed in duplicate. *P<0.05, **P<0.01, ***P<0.001.

Article Snippet: The blots were blocked for 1 h at room temperature in 5% milk proteins/TBS and were incubated overnight at 4 C with 1 : 1000 monoclonal (rabbit) anti-TGF-b1 antibody (R&D systems).

Techniques: Gene Expression, Concentration Assay, Staining, Electrophoresis

Ubiquitin vinyl sulfone (UbVS) inhibits cyclin B1 degradation by depleting available ubiquitin. ( a ) 35 S-labeled cycB1-NT and 20 or 44 μM of wild-type (WT) Ub were introduced into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( b ) Wild-type ubiquitin or forms of ubiquitin (44 μM) bearing single-point mutations in distinct interaction surfaces on ubiquitin, along with radiolabeled substrate, were added to UbVS-treated extract. For panels ( c – e ), mitotically-arrested Xenopus extract was pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Wild-type ubiquitin (44 μM) was added to extract, as indicated. Aliquots were withdrawn at indicated times and analyzed by SDS-PAGE and western blot. ( c ) Ubiquitin status in Xenopus extract was examined by anti-ubiquitin western blot. ( d ) Levels of Ub-charged endogenous UBCH10 were examined by anti-UBCH10 western blot. Aliquots were removed at the indicated times and quenched with either nonreducing sample buffer to examine levels of UBCH10~Ub or reducing sample buffer to examine total levels of UBCH10. ( e ) Same as in d , but levels of endogenous ubiquitin-charged UBCH5 were examined by western blot. Uncropped images of immunoblots are presented in

Journal: Nature cell biology

Article Title: APC/C-mediated multiple monoubiquitination provides an alternative degradation signal for cyclin B1

doi: 10.1038/ncb2425

Figure Lengend Snippet: Ubiquitin vinyl sulfone (UbVS) inhibits cyclin B1 degradation by depleting available ubiquitin. ( a ) 35 S-labeled cycB1-NT and 20 or 44 μM of wild-type (WT) Ub were introduced into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( b ) Wild-type ubiquitin or forms of ubiquitin (44 μM) bearing single-point mutations in distinct interaction surfaces on ubiquitin, along with radiolabeled substrate, were added to UbVS-treated extract. For panels ( c – e ), mitotically-arrested Xenopus extract was pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Wild-type ubiquitin (44 μM) was added to extract, as indicated. Aliquots were withdrawn at indicated times and analyzed by SDS-PAGE and western blot. ( c ) Ubiquitin status in Xenopus extract was examined by anti-ubiquitin western blot. ( d ) Levels of Ub-charged endogenous UBCH10 were examined by anti-UBCH10 western blot. Aliquots were removed at the indicated times and quenched with either nonreducing sample buffer to examine levels of UBCH10~Ub or reducing sample buffer to examine total levels of UBCH10. ( e ) Same as in d , but levels of endogenous ubiquitin-charged UBCH5 were examined by western blot. Uncropped images of immunoblots are presented in

Article Snippet: To generate mutants of cyclin B1, DNA fragments encoding the N-terminal 124 amino acids of wild-type human cyclin B1 (AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAAAATTAATGCTGAAAATAAAGCGAAAATCAACATGGCAGGCGCCAAGCGCGTTCCTACGGCACCGGCGGCAACCTCCAAACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAGCTACAGGCCAAAATGCCTATGAAAAAAGAAGCAAAACCTTCAGCTACCGGTAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTGGTTGATACTGCTAGCAATA) or the same region of the protein with arginine substitutions at all lysine residues (cyc allR ; AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAGAATTAATGCTGAAAATAGAGCGAGAATCAACATGGCAGGCGCCAGGCGCGTTCCTACGGCACCGGCGGCAACCTCCAGACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAGAGTCAGTGAACAGCTACAGGCCAGAATGCCTATGAGAAGAGAAGCAAGACCTTCAGCTACCGGTAGAGTCATTGATAGAAGACTACCAAGACCTCTTGAAAGGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAGAGAAGAAAGACTTTCGCCTGAGCCTATTTTGGTTGATA CTGCTAGCAATA) preceded by 6xHis tag were synthesized (GenScript).

Techniques: Ubiquitin Proteomics, Labeling, SDS Page, Western Blot

Ubiquitin chain formation is not essential for cyclin B1 degradation in UbVS-treated Xenopus extract. 35 S-labeled cycB1-NT and different forms of Ub, where indicated, were introduced concomitantly into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( a ) Ubiquitin types (44 μM) with single lysine-to-arginine mutations at indicated positions or at all three positions Lys11, 48 and 63 (Ub triR ) were added to UbVS-treated extract. Ub WT refers to wild-type ubiquitin and Ub me refers to methylated ubiquitin. ( b ) Ub 11R and substrate were introduced into UbVS-treated extract, and supplemented with Ub 11R or buffer control 15 min after initiation of degradation. ( c ) Ubiquitin types (44 μM) used, as indicated. Ubiquitin Konly refers to ubiquitin that has all of its lysines, except for those specified, mutated to arginines. ( d ) Degradation was measured in the presence of different ubiquitin types (44 μM) containing arginine substitutions at two of the three principle sites of ubiquitin-ubiquitin conjugation by the APC/C.

Journal: Nature cell biology

Article Title: APC/C-mediated multiple monoubiquitination provides an alternative degradation signal for cyclin B1

doi: 10.1038/ncb2425

Figure Lengend Snippet: Ubiquitin chain formation is not essential for cyclin B1 degradation in UbVS-treated Xenopus extract. 35 S-labeled cycB1-NT and different forms of Ub, where indicated, were introduced concomitantly into mitotically-arrested Xenopus extract that had been pre-treated with UbVS (20 μM) or buffer (untreated) for 30 min. Proteolysis was measured by release of trichloroacetic acid (TCA) soluble counts, and plotted as percent of input radiolabeled cycB1-NT. Trends are representative of three or more independent experiments. ( a ) Ubiquitin types (44 μM) with single lysine-to-arginine mutations at indicated positions or at all three positions Lys11, 48 and 63 (Ub triR ) were added to UbVS-treated extract. Ub WT refers to wild-type ubiquitin and Ub me refers to methylated ubiquitin. ( b ) Ub 11R and substrate were introduced into UbVS-treated extract, and supplemented with Ub 11R or buffer control 15 min after initiation of degradation. ( c ) Ubiquitin types (44 μM) used, as indicated. Ubiquitin Konly refers to ubiquitin that has all of its lysines, except for those specified, mutated to arginines. ( d ) Degradation was measured in the presence of different ubiquitin types (44 μM) containing arginine substitutions at two of the three principle sites of ubiquitin-ubiquitin conjugation by the APC/C.

Article Snippet: To generate mutants of cyclin B1, DNA fragments encoding the N-terminal 124 amino acids of wild-type human cyclin B1 (AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAAAATTAATGCTGAAAATAAAGCGAAAATCAACATGGCAGGCGCCAAGCGCGTTCCTACGGCACCGGCGGCAACCTCCAAACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAGCTACAGGCCAAAATGCCTATGAAAAAAGAAGCAAAACCTTCAGCTACCGGTAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTGGTTGATACTGCTAGCAATA) or the same region of the protein with arginine substitutions at all lysine residues (cyc allR ; AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAGAATTAATGCTGAAAATAGAGCGAGAATCAACATGGCAGGCGCCAGGCGCGTTCCTACGGCACCGGCGGCAACCTCCAGACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAGAGTCAGTGAACAGCTACAGGCCAGAATGCCTATGAGAAGAGAAGCAAGACCTTCAGCTACCGGTAGAGTCATTGATAGAAGACTACCAAGACCTCTTGAAAGGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAGAGAAGAAAGACTTTCGCCTGAGCCTATTTTGGTTGATA CTGCTAGCAATA) preceded by 6xHis tag were synthesized (GenScript).

Techniques: Ubiquitin Proteomics, Labeling, Methylation, Control, Conjugation Assay

Cyclin B1 proteolysis depends on Lys11-linked Ub chain formation only when the number of available lysine residues is restricted. ( a ) Sequence comparison of the cyclin B1 N termini from multiple species. Lysine residues are colored in blue; the destruction box (D-box) is colored in orange. ( b ) Schematic representation of the N terminal region (residues 1–88) of human cyclin B1 with lysine residues denoted K in blue and with the D-box motif denoted with an orange rectangle. Cyclin B1 mutants (cyc K64only and cyc K59, 63, 64, 67only ) were generated by substituting lysine with arginine at all but the specified lysine residues within the first 115 amino acids (residues 89–115 not shown). ( c ) Purified full-length wild-type (cyc WT ) or single-lysine (cyc K64only ) cyclin B1, in complex with CDK1, and forms of Ub (20 μM) as indicated were added to mitotic Xenopus egg extract that had been pre-treated with UbVS (20 μM) for 30 min. Stability of the exogenous substrate over time was assessed by SDS-PAGE and cyclin B1 western analysis. ( d ) Performed as in c except the behavior of full-length cyc K59, 63, 64, 67only , in complex with CDK1, was analyzed. Uncropped images of immunoblots are shown in .

Journal: Nature cell biology

Article Title: APC/C-mediated multiple monoubiquitination provides an alternative degradation signal for cyclin B1

doi: 10.1038/ncb2425

Figure Lengend Snippet: Cyclin B1 proteolysis depends on Lys11-linked Ub chain formation only when the number of available lysine residues is restricted. ( a ) Sequence comparison of the cyclin B1 N termini from multiple species. Lysine residues are colored in blue; the destruction box (D-box) is colored in orange. ( b ) Schematic representation of the N terminal region (residues 1–88) of human cyclin B1 with lysine residues denoted K in blue and with the D-box motif denoted with an orange rectangle. Cyclin B1 mutants (cyc K64only and cyc K59, 63, 64, 67only ) were generated by substituting lysine with arginine at all but the specified lysine residues within the first 115 amino acids (residues 89–115 not shown). ( c ) Purified full-length wild-type (cyc WT ) or single-lysine (cyc K64only ) cyclin B1, in complex with CDK1, and forms of Ub (20 μM) as indicated were added to mitotic Xenopus egg extract that had been pre-treated with UbVS (20 μM) for 30 min. Stability of the exogenous substrate over time was assessed by SDS-PAGE and cyclin B1 western analysis. ( d ) Performed as in c except the behavior of full-length cyc K59, 63, 64, 67only , in complex with CDK1, was analyzed. Uncropped images of immunoblots are shown in .

Article Snippet: To generate mutants of cyclin B1, DNA fragments encoding the N-terminal 124 amino acids of wild-type human cyclin B1 (AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAAAATTAATGCTGAAAATAAAGCGAAAATCAACATGGCAGGCGCCAAGCGCGTTCCTACGGCACCGGCGGCAACCTCCAAACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAGCTACAGGCCAAAATGCCTATGAAAAAAGAAGCAAAACCTTCAGCTACCGGTAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTGGTTGATACTGCTAGCAATA) or the same region of the protein with arginine substitutions at all lysine residues (cyc allR ; AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAGAATTAATGCTGAAAATAGAGCGAGAATCAACATGGCAGGCGCCAGGCGCGTTCCTACGGCACCGGCGGCAACCTCCAGACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAGAGTCAGTGAACAGCTACAGGCCAGAATGCCTATGAGAAGAGAAGCAAGACCTTCAGCTACCGGTAGAGTCATTGATAGAAGACTACCAAGACCTCTTGAAAGGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAGAGAAGAAAGACTTTCGCCTGAGCCTATTTTGGTTGATA CTGCTAGCAATA) preceded by 6xHis tag were synthesized (GenScript).

Techniques: Sequencing, Comparison, Generated, Purification, SDS Page, Western Blot

UBCH10 and APC/C catalyze rapid multiple monoubiquitination of cyclin B1 that is sufficient for binding ubiquitin receptors. ( a ) Western analysis of in vitro ubiquitination reaction containing full-length cyclin B1, APC/C immunopurified from mitotically-arrested Xenopus extract, recombinant UBCH10 (100 nM), and forms of Ub (118 μM), as indicated. Ubiquitin types with lysine-to-arginine mutations at one, two, or at all three positions Lys11, 48 and 63 (Ub triR ), as well as methylated ubiquitin (Ub me ) were used. Control “−APC/C” reactions containing all components except for the E3 ligase were performed in parallel. Reactions were allowed to proceed for 15 or 90 min before analysis by SDS-PAGE/western blotting against cyclin B1. ( b ) Time-course of the in vitro ubiquitination of full-length wild-type cyclin B1 with Ub WT or Ub triR and remaining components as in a . ( c – f ) Binding of ubiquitinated cyclin B1 to GST-tagged Ub receptors. Cyclin B1-Ub conjugates were incubated with immobilized receptor proteins for 1 h at 4 °C before reaction products were subjected to SDS-PAGE/western blot analysis against cyclin B1. Equivalent amounts of input (I), flow-through (FT) and bound (B) were loaded in adjacent lanes. Binding experiments with wild-type Rpn10 ( c ) and Rad23 ( e ). Binding with corresponding versions of the receptors lacking the Ub recognition domains, with engineered block substitution of the UIM domain (LAMAL → NNNNN) of Rpn10 ( d ) or deletion of the UBA domains of Rad 23 ( f ).

Journal: Nature cell biology

Article Title: APC/C-mediated multiple monoubiquitination provides an alternative degradation signal for cyclin B1

doi: 10.1038/ncb2425

Figure Lengend Snippet: UBCH10 and APC/C catalyze rapid multiple monoubiquitination of cyclin B1 that is sufficient for binding ubiquitin receptors. ( a ) Western analysis of in vitro ubiquitination reaction containing full-length cyclin B1, APC/C immunopurified from mitotically-arrested Xenopus extract, recombinant UBCH10 (100 nM), and forms of Ub (118 μM), as indicated. Ubiquitin types with lysine-to-arginine mutations at one, two, or at all three positions Lys11, 48 and 63 (Ub triR ), as well as methylated ubiquitin (Ub me ) were used. Control “−APC/C” reactions containing all components except for the E3 ligase were performed in parallel. Reactions were allowed to proceed for 15 or 90 min before analysis by SDS-PAGE/western blotting against cyclin B1. ( b ) Time-course of the in vitro ubiquitination of full-length wild-type cyclin B1 with Ub WT or Ub triR and remaining components as in a . ( c – f ) Binding of ubiquitinated cyclin B1 to GST-tagged Ub receptors. Cyclin B1-Ub conjugates were incubated with immobilized receptor proteins for 1 h at 4 °C before reaction products were subjected to SDS-PAGE/western blot analysis against cyclin B1. Equivalent amounts of input (I), flow-through (FT) and bound (B) were loaded in adjacent lanes. Binding experiments with wild-type Rpn10 ( c ) and Rad23 ( e ). Binding with corresponding versions of the receptors lacking the Ub recognition domains, with engineered block substitution of the UIM domain (LAMAL → NNNNN) of Rpn10 ( d ) or deletion of the UBA domains of Rad 23 ( f ).

Article Snippet: To generate mutants of cyclin B1, DNA fragments encoding the N-terminal 124 amino acids of wild-type human cyclin B1 (AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAAAATTAATGCTGAAAATAAAGCGAAAATCAACATGGCAGGCGCCAAGCGCGTTCCTACGGCACCGGCGGCAACCTCCAAACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAGCTACAGGCCAAAATGCCTATGAAAAAAGAAGCAAAACCTTCAGCTACCGGTAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTGGTTGATACTGCTAGCAATA) or the same region of the protein with arginine substitutions at all lysine residues (cyc allR ; AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAGAATTAATGCTGAAAATAGAGCGAGAATCAACATGGCAGGCGCCAGGCGCGTTCCTACGGCACCGGCGGCAACCTCCAGACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAGAGTCAGTGAACAGCTACAGGCCAGAATGCCTATGAGAAGAGAAGCAAGACCTTCAGCTACCGGTAGAGTCATTGATAGAAGACTACCAAGACCTCTTGAAAGGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAGAGAAGAAAGACTTTCGCCTGAGCCTATTTTGGTTGATA CTGCTAGCAATA) preceded by 6xHis tag were synthesized (GenScript).

Techniques: Binding Assay, Ubiquitin Proteomics, Western Blot, In Vitro, Recombinant, Methylation, Control, SDS Page, Incubation, Blocking Assay

Multiply monoubiquitinated cyclin B1 is rapidly degraded by purified proteasomes and in Xenopus extract. ( a ) In vitro degradation assay with cyclin B1-Ub species generated with immunopurified Xenopus APC/C, recombinant UBCH10 (250 nM), and forms of Ub (145 μM), as indicated and USP14-deficient human proteasomes (20 nM). Aliquots were removed at the indicated times and reaction products analyzed by SDS-PAGE and anti-cyclin B1 western. ( b ) Same as in a , but conjugates were generated with UBC4 as the E2 enzyme. ( c ) Autoradiograph of in vitro APC/C-UBCH10 catalyzed ubiquitination of 35 S-cycB1-NT (1–88) with immunopurified Xenopus APC/C, recombinant UBCH10 (100 nM) and forms of Ub (145 μM) as indicated. Products from a 60-minute ubiquitination assay were separated by SDS-PAGE and analyzed using a phosphorimager. ( d ) CycB1-NT-Ub species from c were incubated with purified human proteasomes (20 nM) reconstituted with or without 20-fold molar excess of GST-tagged wild-type USP14. At indicated times, reactions were terminated by addition of trichloroacetic acid (TCA). Proteolysis was measured by release of TCA soluble counts, and plotted as percent of input radiolabeled cyclin B1 protein. See for additional controls. ( e ) CycB1-NT-Ub species from c were added to interphase Xenopus extract that had been pre-treated with UbVS (15 μM) or buffer control for 30 min. Reactions were terminated by addition of TCA at indicated times. Proteolysis was measured by release of TCA soluble counts, and plotted as percent of input radiolabeled cycB1-NT.

Journal: Nature cell biology

Article Title: APC/C-mediated multiple monoubiquitination provides an alternative degradation signal for cyclin B1

doi: 10.1038/ncb2425

Figure Lengend Snippet: Multiply monoubiquitinated cyclin B1 is rapidly degraded by purified proteasomes and in Xenopus extract. ( a ) In vitro degradation assay with cyclin B1-Ub species generated with immunopurified Xenopus APC/C, recombinant UBCH10 (250 nM), and forms of Ub (145 μM), as indicated and USP14-deficient human proteasomes (20 nM). Aliquots were removed at the indicated times and reaction products analyzed by SDS-PAGE and anti-cyclin B1 western. ( b ) Same as in a , but conjugates were generated with UBC4 as the E2 enzyme. ( c ) Autoradiograph of in vitro APC/C-UBCH10 catalyzed ubiquitination of 35 S-cycB1-NT (1–88) with immunopurified Xenopus APC/C, recombinant UBCH10 (100 nM) and forms of Ub (145 μM) as indicated. Products from a 60-minute ubiquitination assay were separated by SDS-PAGE and analyzed using a phosphorimager. ( d ) CycB1-NT-Ub species from c were incubated with purified human proteasomes (20 nM) reconstituted with or without 20-fold molar excess of GST-tagged wild-type USP14. At indicated times, reactions were terminated by addition of trichloroacetic acid (TCA). Proteolysis was measured by release of TCA soluble counts, and plotted as percent of input radiolabeled cyclin B1 protein. See for additional controls. ( e ) CycB1-NT-Ub species from c were added to interphase Xenopus extract that had been pre-treated with UbVS (15 μM) or buffer control for 30 min. Reactions were terminated by addition of TCA at indicated times. Proteolysis was measured by release of TCA soluble counts, and plotted as percent of input radiolabeled cycB1-NT.

Article Snippet: To generate mutants of cyclin B1, DNA fragments encoding the N-terminal 124 amino acids of wild-type human cyclin B1 (AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAAAATTAATGCTGAAAATAAAGCGAAAATCAACATGGCAGGCGCCAAGCGCGTTCCTACGGCACCGGCGGCAACCTCCAAACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAGCTACAGGCCAAAATGCCTATGAAAAAAGAAGCAAAACCTTCAGCTACCGGTAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTGGTTGATACTGCTAGCAATA) or the same region of the protein with arginine substitutions at all lysine residues (cyc allR ; AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAGAATTAATGCTGAAAATAGAGCGAGAATCAACATGGCAGGCGCCAGGCGCGTTCCTACGGCACCGGCGGCAACCTCCAGACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAGAGTCAGTGAACAGCTACAGGCCAGAATGCCTATGAGAAGAGAAGCAAGACCTTCAGCTACCGGTAGAGTCATTGATAGAAGACTACCAAGACCTCTTGAAAGGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAGAGAAGAAAGACTTTCGCCTGAGCCTATTTTGGTTGATA CTGCTAGCAATA) preceded by 6xHis tag were synthesized (GenScript).

Techniques: Purification, In Vitro, Degradation Assay, Generated, Recombinant, SDS Page, Western Blot, Autoradiography, Ubiquitin Proteomics, Incubation, Control

UBE2S is required for cyclin B1 proteolysis only when ubiquitination is constrained to a single lysine. ( a ) Mitotically-arrested Xenopus extract was immunodepleted with UBE2S antibody or control IgG. Samples were further incubated with Ub agarose (10:1 ratio of extract to resin) to enrich for E2 enzymes and bound proteins were analyzed by SDS-PAGE/immunoblotting. Lanes 4–6 represent 25-fold enrichment of E2 enzymes on Ub agarose. Levels of UBE2S, UBCH10 and APC/C were examined by immunoblotting. Asterisks, nonspecific signal. Uncropped images of immunoblots are shown in . ( b ) Rate of degradation of 35 S-labeled cycB1-NT in UBE2S- or control-depleted mitotic Xenopus extract from a . Recombinant His-UBE2S (10 nM), where indicated, was added to reactions concomitantly with substrate. Proteolysis was measured by release of TCA soluble counts, and plotted as percent of input radiolabeled cycB1-NT. ( c ) Time-course of degradation of full-length cyclin B1 (cyc WT ) or single-lysine-containing mutant (cyc K64only ), each in complex with CDK1, in control- or UBE2S-depleted mitotic Xenopus extract. Recombinant His-UBE2S (10 nM), where indicated, was added to reactions concomitantly with substrate. Cyclin B1 proteolysis was analyzed by SDS-PAGE and immunoblotting. Asterisks represent nonspecific signal. Uncropped images of immunoblots are shown in . ( d ) Model of cyclin B1 degradation in Xenopus cell-cycle extract. The APC/C and the E2 UBCH10 collaborate to transfer ubiquitin monomers to multiple lysine residues on cyclin B1, with subsequent elaboration of short ubiquitin chains containing K63, K48 and K11 linkages, with K11 linkages predominating . Upon achievement of a threshold of ubiquitin mass, which appears to be 4–5 ubiquitin monomers, multiply monoubiquitinated substrate can associate with proteasome-associated ubiquitin receptors and be degraded efficiently. However, when the number of lysine residues in cyclin B1 is restricted, ubiquitination catalyzed by UBCH10 is insufficient for rapid proteolysis and the activity of UBE2S in extending K11-linked ubiquitin polymers becomes important for efficient degradation.

Journal: Nature cell biology

Article Title: APC/C-mediated multiple monoubiquitination provides an alternative degradation signal for cyclin B1

doi: 10.1038/ncb2425

Figure Lengend Snippet: UBE2S is required for cyclin B1 proteolysis only when ubiquitination is constrained to a single lysine. ( a ) Mitotically-arrested Xenopus extract was immunodepleted with UBE2S antibody or control IgG. Samples were further incubated with Ub agarose (10:1 ratio of extract to resin) to enrich for E2 enzymes and bound proteins were analyzed by SDS-PAGE/immunoblotting. Lanes 4–6 represent 25-fold enrichment of E2 enzymes on Ub agarose. Levels of UBE2S, UBCH10 and APC/C were examined by immunoblotting. Asterisks, nonspecific signal. Uncropped images of immunoblots are shown in . ( b ) Rate of degradation of 35 S-labeled cycB1-NT in UBE2S- or control-depleted mitotic Xenopus extract from a . Recombinant His-UBE2S (10 nM), where indicated, was added to reactions concomitantly with substrate. Proteolysis was measured by release of TCA soluble counts, and plotted as percent of input radiolabeled cycB1-NT. ( c ) Time-course of degradation of full-length cyclin B1 (cyc WT ) or single-lysine-containing mutant (cyc K64only ), each in complex with CDK1, in control- or UBE2S-depleted mitotic Xenopus extract. Recombinant His-UBE2S (10 nM), where indicated, was added to reactions concomitantly with substrate. Cyclin B1 proteolysis was analyzed by SDS-PAGE and immunoblotting. Asterisks represent nonspecific signal. Uncropped images of immunoblots are shown in . ( d ) Model of cyclin B1 degradation in Xenopus cell-cycle extract. The APC/C and the E2 UBCH10 collaborate to transfer ubiquitin monomers to multiple lysine residues on cyclin B1, with subsequent elaboration of short ubiquitin chains containing K63, K48 and K11 linkages, with K11 linkages predominating . Upon achievement of a threshold of ubiquitin mass, which appears to be 4–5 ubiquitin monomers, multiply monoubiquitinated substrate can associate with proteasome-associated ubiquitin receptors and be degraded efficiently. However, when the number of lysine residues in cyclin B1 is restricted, ubiquitination catalyzed by UBCH10 is insufficient for rapid proteolysis and the activity of UBE2S in extending K11-linked ubiquitin polymers becomes important for efficient degradation.

Article Snippet: To generate mutants of cyclin B1, DNA fragments encoding the N-terminal 124 amino acids of wild-type human cyclin B1 (AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAAAATTAATGCTGAAAATAAAGCGAAAATCAACATGGCAGGCGCCAAGCGCGTTCCTACGGCACCGGCGGCAACCTCCAAACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAGCTACAGGCCAAAATGCCTATGAAAAAAGAAGCAAAACCTTCAGCTACCGGTAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTGGTTGATACTGCTAGCAATA) or the same region of the protein with arginine substitutions at all lysine residues (cyc allR ; AACCGGTCCGAAACCGTCGACATGTCGCATCACCATCACCATCACGGCTCGATGGCGCTCCGAGTCACGCGTAACTCGAGAATTAATGCTGAAAATAGAGCGAGAATCAACATGGCAGGCGCCAGGCGCGTTCCTACGGCACCGGCGGCAACCTCCAGACCCGGGCTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAGAGTCAGTGAACAGCTACAGGCCAGAATGCCTATGAGAAGAGAAGCAAGACCTTCAGCTACCGGTAGAGTCATTGATAGAAGACTACCAAGACCTCTTGAAAGGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAGCCAGAACCTGAGCCTGTTAGAGAAGAAAGACTTTCGCCTGAGCCTATTTTGGTTGATA CTGCTAGCAATA) preceded by 6xHis tag were synthesized (GenScript).

Techniques: Ubiquitin Proteomics, Control, Incubation, SDS Page, Western Blot, Labeling, Recombinant, Mutagenesis, Activity Assay

Independence of PIM1 expression and cell cycle arrest. A, DNA histogram analysis of RWPE-2 cells after docetaxel 10 or 100 nm treatments for 24 h. sG1, a sub-G1 cell population with less than 2 n DNA content. G1 and G2, the appearance of cells in G0/G1 or G2/M phases of the cell cycle. B, immunoblot analysis of cyclin B1 and PIM1 expression after docetaxel 10 nm (B, left) or 100 nm (B, right) treatment at various time points.

Journal: The Journal of Biological Chemistry

Article Title: The PIM1 Kinase Is a Critical Component of a Survival Pathway Activated by Docetaxel and Promotes Survival of Docetaxel-treated Prostate Cancer Cells * S⃞

doi: 10.1074/jbc.M709479200

Figure Lengend Snippet: Independence of PIM1 expression and cell cycle arrest. A, DNA histogram analysis of RWPE-2 cells after docetaxel 10 or 100 nm treatments for 24 h. sG1, a sub-G1 cell population with less than 2 n DNA content. G1 and G2, the appearance of cells in G0/G1 or G2/M phases of the cell cycle. B, immunoblot analysis of cyclin B1 and PIM1 expression after docetaxel 10 nm (B, left) or 100 nm (B, right) treatment at various time points.

Article Snippet: The following monoclonal antibodies were used: anti-β-ACTIN (clone AC-15; Sigma), anti-PIM1 (clone 12H8; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-BCL xL (clone H-5; Santa Cruz Biotechnology), anti-phospho-STAT3 (Tyr 705 ) (clone 3E2; Cell Signaling), anti-total STAT3 (clone 84; BD Biosciences), anti-GAPDH (clone FL-335; Santa Cruz Biotechnology), anti-PRDX5 (Transduction Laboratories), and anti-human cyclin B1 (clone GNS-1; BD Biosciences).

Techniques: Expressing, Western Blot